Search results

RE: If you could create an Ability for thr TCG Pretty much all of the abilities you suggested are really cool, some of the best I've seen in this thread... and most are balanced enough. I particularly love Head Start, Prominence, and Lordly Stance.

LOL! Where did you take/find that snowglobe picture?

Mods, please lock. :-)

Banned for liking Pocky... and unbanned for having a cool link in your siggy.

@Snivylover- I don't think I can do the Magikarp because it would probably do well with a less serious name that the kind I give. Chingling: Pinponda- from the Japanese words for "ding dong" Kushii- from the Japanese word "beautiful" Medicham: Polem/Polemi/Polemihiko- from the Greek words...

Neroek/Neroekri/Neroekrix/Neroekrixi- a combination of the Greek words for "water" and "blast" Umika/Umikame/Kawaka/Kawakame- a combination of the Japanese words for "ocean" or "river" and "turtle"

I have a rather strange naming style, but here it is anyway. For the Dragonite: Kitsubasa- a combination of the Japanese words for "tree" and "wing" Gidrak/Gidrako/Gidrakos- a combination of the Greek words of "earth" and "dragon"- also sounds like "giga" For the Emboar...

RE: The "Pull Rates" Thread Thanks, Viper. Those are pretty bad odds! I guess boxes aren't the best way to go if I'm looking to snap up some full arts.

How do you bike on the curb? Unless the curbs in your area are very wide, that doesn't sound like it would even be possible (for long periods of time at least.) Unless that's not what you meant... Other than that, I think that it's fine for cyclists to be on the road as long as they're not...

The "I Want Petunia" ads they used to have for Bob's Furniture were downright HORRIBLE.

I was just saying I like your H/H game. A compliment, like you said.

RE: Spoink's Sprites @Shaymin- I cannot do glow either. Anything that only Shinx107 can do must be temporarily put on hold because she is not here.

You have no comments. I had better add one.

I've never played Emerald. My first Pokemon game was Pearl. I'm a noob, the only games I've played are Pearl, Heart Gold, and White. White is the best, though, and not just because it's the newest. Partially because I love Tepig so much, though. I fell in love with it the moment it was...

Haha... I really should specify my gender, so that people don't call me "sir" Unless you usually go around calling females "sir."

You made the epic H/H game. :-)

Whoa, 999 posts! Take a screenshot! (And take one at 1000 posts too!)

Spammity Spam Spam. (You were jealous of me spamming DNA, so... you want to be spammed.)

TGCTTCGAACTTCGGACTAGTCGAAAAGGCT EDIT: Just so this isn't spam, I'll add: What is your favorite Pokemon game?

You viewed my profile. Stalker.